| MirGeneDB ID | Ocu-Mir-506-P7e | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-506 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | ACUCAAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Rabbit (Oryctolagus cuniculus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | ocu-mir-509c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ocu-Mir-506-P1 Ocu-Mir-506-P2 Ocu-Mir-506-P3 Ocu-Mir-506-P5 Ocu-Mir-506-P6 Ocu-Mir-506-P7d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Cfa-Mir-506-P7 Mmu-Mir-506-P7 Rno-Mir-506-P7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | O. cuniculus | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (oryCun2_add) |
chrUn0002: 10687771-10687828 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-506-P7e) |
Mir-506-P6
chrUn0002: 10678464-10678522 [-]
UCSC
Ensembl
Mir-506-P7e chrUn0002: 10687771-10687828 [-] UCSC Ensembl Mir-506-P1 chrUn0002: 10694554-10694611 [-] UCSC Ensembl Mir-506-P3 chrUn0002: 10705716-10705773 [-] UCSC Ensembl Mir-506-P2 chrUn0002: 10707176-10707233 [-] UCSC Ensembl Mir-506-P7d chrUn0002: 10711587-10711644 [-] UCSC Ensembl Mir-506-P5 chrUn0002: 10723771-10723827 [-] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | CCAUCCCUGGAUACACUGUGUGCUGUGCUCUACUCAAGACAGUGGCAAUCAUGUAUAAUUAAAUAUGAUUGACACGUCUAUGAGUGGAAUAAGGCAUGACACAUACUACGUAAGUGAUGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CCAUCCCUGGAUACACU- - G C -| A G UAUA GU GUGCU UG UCUACUCA AGAC GUG CAAUCAUG A CA UACGG AU AGGUGAGU UCUG CAC GUUAGUAU U UAGUGAAUGCAUCAUACA G A A A^ - A AAAU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ocu-Mir-506-P7e_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0048517 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UACUCAAGACAGUGGCAAUCAUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ocu-Mir-506-P7e_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0048518 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- UGAUUGACACGUCUAUGAGUGGA -58
Get sequence
|






