| MirGeneDB ID | Ocu-Mir-24-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-24 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GGCUCAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Rabbit (Oryctolagus cuniculus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | ocu-mir-24-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ocu-Mir-24-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-24-P3 Ami-Mir-24-P3 Bta-Mir-24-P3 Cfa-Mir-24-P3 Cmi-Mir-24-P3 Cpi-Mir-24-P3 Cpo-Mir-24-P3 Dno-Mir-24-P3 Dre-Mir-24-P3 Ete-Mir-24-P3 Gga-Mir-24-P3 Gja-Mir-24-P3 Gmo-Mir-24-P3 Hsa-Mir-24-P3 Lch-Mir-24-P3 Loc-Mir-24-P3 Mdo-Mir-24-P3 Mml-Mir-24-P3 Mmu-Mir-24-P3 Mun-Mir-24-P3a Mun-Mir-24-P3b Oan-Mir-24-P3 Pbv-Mir-24-P3 Rno-Mir-24-P3 Sha-Mir-24-P3 Sto-Mir-24-P3 Tgu-Mir-24-P3 Tni-Mir-24-P3 Xla-Mir-24-P3c Xla-Mir-24-P3d Xtr-Mir-24-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (oryCun2_add) |
chrUn0990: 23718-23778 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-24-P3) |
Mir-181-P2c
chrUn0990: 3930-3992 [-]
UCSC
Ensembl
Mir-181-P1c chrUn0990: 4071-4131 [-] UCSC Ensembl Mir-24-P3 chrUn0990: 23718-23778 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | GCCGCCCGGCCGCCCUGGGCUCCGCCUCCCGUACCUACUGAGCUGAAACACAGUUGAUGUCGUGGACACUGGCUCAGUUCAGCAGGAACAGGAGUCGAGCCCGCUUGGACGCUGGCGGCCGGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GCCGCCCGGCCGCCCUG---| C C C A A AACA UGAUGU GGCUC G CUCC GU CCU CUGAGCUGA CAGU \ CCGAG C GAGG CA GGA GACUUGACU GUCA C GCCGGCGGUCGCAGGUUCGC^ - U A A C CG-- CAGGUG . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | Although not well supported by deep read data all taxa sequenced in this study show the same read pattern and better more deeply sequenced vertebrate taxa are all clearly Group 2 miRNAs suggesting that this too is likely a Group 2 miRNA. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ocu-Mir-24-P3_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0048132 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GUACCUACUGAGCUGAAACACAGU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ocu-Mir-24-P3_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0048131 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
39- UGGCUCAGUUCAGCAGGAACAG -61
Get sequence
|






