| MirGeneDB ID | Cpi-Mir-24-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-24 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GGCUCAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Western painted turtle (Chrysemys picta bellii) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cpi-mir-24-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cpi-Mir-24-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-24-P3 Ami-Mir-24-P3 Bta-Mir-24-P3 Cfa-Mir-24-P3 Cmi-Mir-24-P3 Cpo-Mir-24-P3 Dno-Mir-24-P3 Dre-Mir-24-P3 Ete-Mir-24-P3 Gga-Mir-24-P3 Gja-Mir-24-P3 Gmo-Mir-24-P3 Hsa-Mir-24-P3 Lch-Mir-24-P3 Loc-Mir-24-P3 Mdo-Mir-24-P3 Mml-Mir-24-P3 Mmu-Mir-24-P3 Mun-Mir-24-P3a Mun-Mir-24-P3b Oan-Mir-24-P3 Ocu-Mir-24-P3 Pbv-Mir-24-P3 Rno-Mir-24-P3 Sha-Mir-24-P3 Sto-Mir-24-P3 Tgu-Mir-24-P3 Tni-Mir-24-P3 Xla-Mir-24-P3c Xla-Mir-24-P3d Xtr-Mir-24-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (chrPic1) |
JH584948: 868114-868173 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-24-P3) |
Mir-24-P3
JH584948: 868114-868173 [-]
UCSC
Ensembl
Mir-27-P3 JH584948: 868327-868390 [-] UCSC Ensembl Mir-23-P3 JH584948: 868693-868754 [-] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | GCCCUGCCGCGCUCCCGGGCUCUGCCUCCCGUGCCUACUGAGCUGAUACUCAGUCGCUUUGCUUAAACUGGCUCAGUUCAGCAGGAACAGGAGUCGGGCUCCAGCCUCGCGCCGGCCAGAGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GCCCUGCCGCGCUCCCG---| U C C G A UAC CGCUU GGC CUG CUCC GU CCU CUGAGCUGA UCAGU U UCG GGC GAGG CA GGA GACUUGACU GGUCA G AGACCGGCCGCGCUCCGACC^ - U A A C C-- AAUUC . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | Most other vertebrates are clearly Group 2 but this taxon does not seem to express the untemplated 3'U at significantly high levels. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cpi-Mir-24-P3_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0037659 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GUGCCUACUGAGCUGAUACUCAGU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cpi-Mir-24-P3_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0037658 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence
|






