| MirGeneDB ID | Ocu-Mir-24-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-24 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GGCUCAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Rabbit (Oryctolagus cuniculus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | ocu-mir-24-1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ocu-Mir-24-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-24-P2 Ami-Mir-24-P2 Bta-Mir-24-P2 Cfa-Mir-24-P2 Cmi-Mir-24-P2 Cpi-Mir-24-P2 Cpo-Mir-24-P2 Dno-Mir-24-P2 Dre-Mir-24-P2a Dre-Mir-24-P2b Ete-Mir-24-P2 Gga-Mir-24-P2 Gmo-Mir-24-P2b Hsa-Mir-24-P2 Lch-Mir-24-P2 Loc-Mir-24-P2 Mdo-Mir-24-P2 Mml-Mir-24-P2 Mmu-Mir-24-P2 Mun-Mir-24-P2 Oan-Mir-24-P2 Pbv-Mir-24-P2 Rno-Mir-24-P2 Sha-Mir-24-P2 Spt-Mir-24-P2 Sto-Mir-24-P2 Tgu-Mir-24-P2 Tni-Mir-24-P2b Xla-Mir-24-P2c Xla-Mir-24-P2d Xtr-Mir-24-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (oryCun2_add) |
chr1: 74102787-74102846 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-24-P2) |
Mir-23-P2
chr1: 74102158-74102217 [+]
UCSC
Ensembl
Mir-27-P2 chr1: 74102379-74102441 [+] UCSC Ensembl Mir-24-P2 chr1: 74102787-74102846 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | CUCCGGGCUGCCGAUUGGACCCGCCCUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCGUUUCACACACUGGCUCAGUUCAGCAGGAACAGGAGUGGAGCCCUCGAGCCAAAAGCCUCGCCGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CUCCGGGCUGCCGAUUGGACCCG- -| G G A UA UCUCGU CC CUCC GU CCU CUGAGCUGA UCAGU \ GG GAGG CA GGA GACUUGACU GGUCA U CCGCUCCGAAAACCGAGCUCCCGA U^ A A C C- CACACU . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | Although not well supported by deep read data all taxa sequenced in this study show the same read pattern and better more deeply sequenced vertebrate taxa are all clearly Group 2 miRNAs suggesting that this too is likely a Group 2 miRNA. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ocu-Mir-24-P2_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0048130 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GUGCCUACUGAGCUGAUAUCAGU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ocu-Mir-24-P2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0048131 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence
|






