| MirGeneDB ID | Lgi-Mir-242-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-242 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UGCGUAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Owl limpet (Lottia gigantea) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | lgi-mir-242a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Lgi-Mir-242-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Bfl-Mir-242 Bpl-Mir-242 Cbr-Mir-242 Cel-Mir-242 Cgi-Mir-242 Cte-Mir-242 Lan-Mir-242 Npo-Mir-242 Pfl-Mir-242 Pmi-Mir-242 Sko-Mir-242 Spu-Mir-242 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | L. gigantea | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Lotgi1) |
LOTGIsca_16: 1142666-1142720 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-242-P2) |
Mir-242-P2
LOTGIsca_16: 1142666-1142720 [-]
Ensembl
Mir-242-P1 LOTGIsca_16: 1142985-1143041 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | ACAAUCUGCUACAUGACAGGAAUAAGGUUUUUGCGUAGGCGUUGUGCACAGUUAAAUAGAUAUUGUGUAUUCCCCCUAAGCAUCAAAUUUUAUUACUAGAACAACUUAAUGGCACGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 ACAAUCUGCUACAUGAC- G U-| G CGUU UAAA AG AAUAAGGUUU UGC UAGG GUGCACAGU \ UC UUAUUUUAAA ACG AUCC UAUGUGUUA U CACGGUAAUUCAACAAGA A CU^ A CCCU UAGA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Lgi-Mir-242-P2_5p (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0009590 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UUGCGUAGGCGUUGUGCACAGU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Lgi-Mir-242-P2_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
33- UGUGUAUUCCCCCUAAGCAUCA -55
Get sequence
|






