| MirGeneDB ID | Ocu-Mir-362-P6 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-362 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUGCACC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Rabbit (Oryctolagus cuniculus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | ocu-mir-502b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ocu-Mir-362-P1 Ocu-Mir-362-P2 Ocu-Mir-362-P3 Ocu-Mir-362-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Bta-Mir-362-P6 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (oryCun2_add) |
chrX: 34235397-34235456 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-362-P6) |
Mir-188-P2
chrX: 34232287-34232345 [+]
UCSC
Ensembl
Mir-188-P1 chrX: 34232654-34232713 [+] UCSC Ensembl Mir-362-P6 chrX: 34235397-34235456 [+] UCSC Ensembl Mir-362-P2 chrX: 34237519-34237579 [+] UCSC Ensembl Mir-362-P1 chrX: 34238027-34238085 [+] UCSC Ensembl Mir-362-P3 chrX: 34238810-34238868 [+] UCSC Ensembl Mir-188-P3 chrX: 34242048-34242106 [+] UCSC Ensembl Mir-362-P4 chrX: 34243943-34244001 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | GCUUGAGCCUUCUCUUUUGCUCUUUCUCUCUAAUCCUUGAUACCUGGUGUUAGUGCUUUCUAUGUGCAAUGCACCUGGGCAAGGAUUUAGAGUGGGAUGAGCCUUAUCUGCCGAUGGAAGGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GCUUGAGCCUUCUCUUUU - UU U -| AUA U UA- GCUUU GCUC U C CUCU AAUCCUUG CC GGUGU GU \ CGAG A G GAGA UUAGGAAC GG CCACG CG C GAAGGUAGCCGUCUAUUC U GG U U^ G-- U UAA UGUAU . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is an orthologous sequence to the rabbit and cow in both human and Cavia (and elephant) but no reads from human or Cavia and a very weak secondary structure. This might be an example of a recently lost miRNA. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ocu-Mir-362-P6_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0048497 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UAAUCCUUGAUACCUGGUGUUAGU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ocu-Mir-362-P6_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0048498 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- AAUGCACCUGGGCAAGGAUUUAG -60
Get sequence
|






