| MirGeneDB ID | Oan-Let-7-P2c1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | LET-7 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GAGGUAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Platypus (Ornithorhynchus anatinus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | oan-let-7d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Oan-Let-7-P1b Oan-Let-7-P1c Oan-Let-7-P1d Oan-Let-7-P2a1 Oan-Let-7-P2a2 Oan-Let-7-P2a3 Oan-Let-7-P2a4 Oan-Let-7-P2b1 Oan-Let-7-P2b2 Oan-Let-7-P2b3 Oan-Let-7-P2b4 Oan-Let-7-P2c2 Oan-Let-7-P2c3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Let-7 Aca-Let-7-P2c1 Ami-Let-7-P2c1 Bge-Let-7 Bpl-Let-7 Bta-Let-7-P2c1 Cfa-Let-7-P2c1 Cgi-Let-7 Cli-Let-7-P2c1 Cmi-Let-7-P2c1 Cpi-Let-7-P2c1 Cpo-Let-7-P2c1 Cte-Let-7 Dan-Let-7 Dma-Let-7 Dme-Let-7 Dmo-Let-7 Dno-Let-7-P2c1 Dpu-Let-7 Dsi-Let-7 Dya-Let-7 Esc-Let-7 Ete-Let-7-P2c1 Gga-Let-7-P2c1 Gja-Let-7-P2c1 Hme-Let-7 Hsa-Let-7-P2c1 Isc-Let-7 Lan-Let-7 Lch-Let-7-P2c1 Lgi-Let-7 Loc-Let-7-P2c1 Mdo-Let-7-P2c1 Mml-Let-7-P2c1 Mmu-Let-7-P2c1 Mun-Let-7-P2c1 Npo-Let-7 Obi-Let-7 Ocu-Let-7-P2c1 Ovu-Let-7 Pbv-Let-7-P2c1 Pfl-Let-7 Pmi-Let-7 Rno-Let-7-P2c1 Sha-Let-7-P2c1 Sko-Let-7 Spt-Let-7-P2c1 Spu-Let-7 Sto-Let-7-P2c1 Tca-Let-7 Tgu-Let-7-P2c1 Xbo-Let-7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (mOrnAna1.p.v1_plustraces) |
NC_041749.1: 77607860-77607934 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Let-7-P2c1) |
Let-7-P2b1
NC_041749.1: 77606476-77606553 [+]
Let-7-P2c1 NC_041749.1: 77607860-77607934 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | AACCUUAGAAGAAACUAUGGGCUCCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGUGAUUUUGCUCAUAAGGUGUUAACUAUACAACCUGCUGCCUUUCUUAGGGCUUUAUUAUUACACCGGGACCUGUGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AACCUUAGAAGAAACUAU---| U A C UUAGGGCAGUGAUU GGGC CCUAGGA GAGGUAGUAGGUUG AUAGUU U UUCG GGAUUCU UUCCGUCGUCCAAC UAUCAA U UGUCCAGGGCCACAUUAUUAU^ - - A UUGUGGAAUACUCG 130 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | This is a Group 2 in human according to Kim et al. (2017) but because there is a templated 3' U it is not possible according to read data to classify it as such in other taxa although the secondary structure is consistent with this categorization. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Oan-Let-7-P2c1_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0007234 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGAGGUAGUAGGUUGCAUAGUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Oan-Let-7-P2c1_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0007235 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
54- CUAUACAACCUGCUGCCUUUC -75
Get sequence
|






