| MirGeneDB ID | Cpi-Mir-2970 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2970 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | ACAGUCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Western painted turtle (Chrysemys picta bellii) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cpi-mir-2970 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-2970 Ami-Mir-2970 Cli-Mir-2970 Gga-Mir-2970 Gja-Mir-2970 Lch-Mir-2970 Mdo-Mir-2970 Mun-Mir-2970 Oan-Mir-2970 Pbv-Mir-2970 Sha-Mir-2970 Spt-Mir-2970 Tgu-Mir-2970 Xla-Mir-2970-P1 Xla-Mir-2970-P2 Xtr-Mir-2970 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Sarcopterygii | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Sarcopterygii | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (chrPic1) |
JH584670: 1164353-1164411 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2970) |
Mir-2970
JH584670: 1164353-1164411 [-]
UCSC
Ensembl
Mir-425 JH584670: 1165773-1165833 [-] UCSC Ensembl Mir-191 JH584670: 1168666-1168729 [-] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | GAGGCGCACAGGUCUCUUCCUGUCACUGCAGACAGUCAGUAGUUGGUCUGGCGAGAGCAGGAAUUCUCAGAUCACCUCUUGGCUGUGAGUGGUGGUGCAGAGAACACUGCACCUUUGCUGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GAGGCGCACAGGUCUCUUC --| UG AG U U CGAGAGC CUGU CAC C ACAGUCAG AG UGGUCUGG \ GACG GUG G UGUCGGUU UC ACUAGACU A UCGUUUCCACGUCACAAGA UG^ GU AG C C CUUAAGG 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Dicer cut +1 on the 3p arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cpi-Mir-2970_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0037945 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GACAGUCAGUAGUUGGUCUGGC -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cpi-Mir-2970_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0037946 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- CAGAUCACCUCUUGGCUGUGAG -59
Get sequence
|






