| MirGeneDB ID | Dsi-Mir-9-P9 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-9 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UAAAGCU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Fruit fly (Drosophila simulans) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | dsi-mir-4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Dsi-Mir-9-P10 Dsi-Mir-9-P11 Dsi-Mir-9-P12-v1 Dsi-Mir-9-P12-v2 Dsi-Mir-9-P13 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Bfl-Mir-9 Bla-Mir-9 Bpl-Mir-9 Cin-Mir-9 Cte-Mir-9 Dan-Mir-9-P9 Dme-Mir-9-P9 Dmo-Mir-9-P9 Dya-Mir-9-P9 Esc-Mir-9 Isc-Mir-9 Lan-Mir-9 Lgi-Mir-9 Npo-Mir-9 Obi-Mir-9 Ovu-Mir-9 Pmi-Mir-9 Spu-Mir-9 Tca-Mir-9-o9-v1 Tca-Mir-9-o9-v2 Xbo-Mir-9 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Drosophila | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Drosophila_simulans.ASM75419v3.dna.toplevel) |
2R: 16151148-16151204 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-9-P9) |
Mir-2-P6c
2R: 16150571-16150636 [-]
UCSC
Ensembl
Mir-2-P6b 2R: 16150723-16150784 [-] UCSC Ensembl Mir-2-P6a 2R: 16150863-16150925 [-] UCSC Ensembl Mir-2-P5 2R: 16151011-16151070 [-] UCSC Ensembl Mir-9-P9 2R: 16151148-16151204 [-] UCSC Ensembl Mir-279-P2 2R: 16151283-16151358 [-] UCSC Ensembl Mir-3-P1 2R: 16151447-16151503 [-] UCSC Ensembl Mir-3-P2 2R: 16151557-16151615 [-] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | CAAAUAUUCUGUGGCGGUUGCAAUUAGUUUCUUUGGUCGUCCAGCCUUAGGUGACUUUUCCGAUCAUAAAGCUAGACAACCAUUGAAGUUCGUUGUGGCAUUAGCAGCACCACAAGUGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CAAAUAUUCUGUGGCGG--|UG U GU UU C C CUUAG CUUU U CAAU A UUC UGGU GUC AGC GUGA \ G GUUG U AAG ACCA CAG UCG UACU U UGAACACCACGACGAUUAC^GU C UG UU A A AAA-- AGCC 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Dsi-Mir-9-P9_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CUUUGGUCGUCCAGCCUUAGGUGA -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Dsi-Mir-9-P9_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0008842 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- AUAAAGCUAGACAACCAUUGAA -57
Get sequence
|






