| MirGeneDB ID | Cte-Mir-279-o12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-279 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GACUAGA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Polychaete worm (Capitella teleta) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cte-mir-996 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cte-Mir-279-o11 Cte-Mir-279-o13 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Bpl-Mir-279 Cgi-Mir-279 Esc-Mir-279 Isc-Mir-279 Lgi-Mir-279 Lpo-Mir-279-P12 Npo-Mir-279 Obi-Mir-279 Ovu-Mir-279 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | C. teleta | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Capitella_teleta_v1.0) |
CAPTEscaffold_39: 146002-146056 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-279-o12) |
Mir-279-o12
CAPTEscaffold_39: 146002-146056 [+]
Ensembl
Mir-279-o13 CAPTEscaffold_39: 146223-146291 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | UUUCACUGUUGGCUGAUGCCAUUGGCGGAGGCGGGUGUGCUGUCUGGUGCGUGUGUUUCACCAUGACUAGAUAACACAUUCGUCUCUGCCUCUUGAGCACCCUCGUCCUGUUAUGGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UUUCACUGUUGGCUGAUGC- UU-| C G UGU CA GGCGGAGGCGGGUGUG UGUCUGGU CGUG U GU CCGUCUCUGCUUACAC AUAGAUCA GUAC U GUAUUGUCCUGCUCCCACGA UCU^ A - CAC 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of protostomes and how the Drosophila Mir-279s relate to the other invertebrate Mir-279s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cte-Mir-279-o12_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GCGGGUGUGCUGUCUGGUGCGUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cte-Mir-279-o12_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0013552 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
33- UGACUAGAUAACACAUUCGUCU -55
Get sequence
|






