| MirGeneDB ID | Pma-Mir-92-P2g | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Sea Lamprey (Petromyzon marinus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pma-mir-25b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pma-Mir-92-P1g Pma-Mir-92-P1h Pma-Mir-92-P1o1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Asu-Mir-92 Bfl-Mir-92-o2 Bla-Mir-92-o2 Cel-Mir-92 Esc-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | P. marinus | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_010993605.1_kPetMar1.pri_genomic) |
NC_046115.1: 754312-754371 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-P2g) |
Mir-17-P1g
NC_046115.1: 748761-748823 [+]
UCSC
Ensembl
Mir-17-P2g NC_046115.1: 749056-749119 [+] UCSC Ensembl Mir-17-P3g NC_046115.1: 749682-749742 [+] UCSC Ensembl Mir-19-P1g NC_046115.1: 750373-750438 [+] UCSC Ensembl Mir-17-P4g NC_046115.1: 751997-752055 [+] UCSC Ensembl Mir-19-P2g NC_046115.1: 752202-752261 [+] UCSC Ensembl Mir-92-P1g NC_046115.1: 752414-752471 [+] UCSC Ensembl Mir-92-P2g NC_046115.1: 754312-754371 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | GAUGCGGGGUCUCGUCUGGACGGCGCGAGCAGGCGGAGACUGGAGCAAGUGCUCUACACUCGUGGUGGCAUUGCACUAGUCUCAGUCUGCCCGAGUCGCCGCCCGAAACUUUCACCACCCGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GAUGCGGGGUCUCGUCU---| A G A G A G CUACAC GG CGGC CG GCAGGC GAGACUGG GCAA UGCU \ CC GCUG GC CGUCUG CUCUGAUC CGUU ACGG U CCCACCACUUUCAAAGCCCG^ - A C A A - UGGUGC . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Drosha site +1 on the 5p arm relative to what is annotated here. There is an indel in the asssembled genome relative to the miRBase entry. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pma-Mir-92-P2g_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0019406 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGCGGAGACUGGAGCAAGUGCU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pma-Mir-92-P2g_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0019407 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- CAUUGCACUAGUCUCAGUCUGC -60
Get sequence
|






