| MirGeneDB ID | Pfl-Mir-22-o2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-22 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CAGCUGC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Ptychodera (Ptychodera flava) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pfl-Mir-22-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-22-P2 Asu-Mir-22-P2 Bge-Mir-22-P2 Cbr-Mir-22-P2-v1 Cbr-Mir-22-P2-v2 Cel-Mir-22-P2 Cgi-Mir-22-P2 Csc-Mir-22-P2 Cte-Mir-22-P2 Dan-Mir-22-P2 Dma-Mir-22-P2 Dme-Mir-22-P2 Dmo-Mir-22-P2 Dpu-Mir-22-P2 Dsi-Mir-22-P2 Dya-Mir-22-P2 Esc-Mir-22-P2 Hme-Mir-22-P2 Isc-Mir-22-P2 Lan-Mir-22-P2 Lgi-Mir-22-P2 Lpo-Mir-22-P2a Lpo-Mir-22-P2b Lpo-Mir-22-P2c Lpo-Mir-22-P2d Npo-Mir-22-P2 Ovu-Mir-22-P2 Pmi-Mir-22-o2 Sko-Mir-22-o2 Spu-Mir-22-o2 Tca-Mir-22-P2-v1 Tca-Mir-22-P2-v2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Ambulacraria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Pfl) |
LD346721.1: 582412-582474 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | CUCAAAUAAGUGCAAUGCUUUGCAUUGCUACACUUCACGCUGCAAGCUAUUGUCAAGUGGUUUAAAUGUCAACAGCUGCUACGUGGAGUGGAGCAAGGUCAAAGGUCAUUUCUUCCAGUCAUAGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CUCAAAUAAGUGCAAUG-- -|A A CU A A UCAAGUGG CUUUG C UUGCU CACUUCACG GCA GCU UUG \ GAAAC G AACGA GUGAGGUGC CGU CGA AAC U AUACUGACCUUCUUUACUG U^G G AU - C UGUAAAUU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is unclear if this paralogue group represents the ancestral Mir-22-P2 gene that is seed shifted or a new paralogue derived from the ancestral P1 gene. It is also unclear if this gene is orthologous to the Mir-22-o1 gene in Branchiostoma and Xenoturbella. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pfl-Mir-22-o2_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CACUUCACGCUGCAAGCUAUUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pfl-Mir-22-o2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
41- ACAGCUGCUACGUGGAGUGGAG -63
Get sequence
|






