| MirGeneDB ID | Ocu-Mir-127 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-127 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CGGAUCC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Rabbit (Oryctolagus cuniculus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | ocu-mir-127 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Bta-Mir-127 Cfa-Mir-127 Cpo-Mir-127 Dno-Mir-127 Ete-Mir-127 Hsa-Mir-127 Mml-Mir-127 Mmu-Mir-127 Rno-Mir-127 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (oryCun2_add) |
chrUn0352: 7903-7958 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-127) |
Mir-337-v1
chrUn0352: 1562-1622 [+]
UCSC
Ensembl
Mir-337-v2 chrUn0352: 1562-1622 [+] UCSC Ensembl Mir-433 chrUn0352: 6784-6857 [+] UCSC Ensembl Mir-127 chrUn0352: 7903-7958 [+] UCSC Ensembl Mir-432 chrUn0352: 9852-9920 [+] UCSC Ensembl Mir-136-v1 chrUn0352: 10072-10127 [+] UCSC Ensembl Mir-136-v2 chrUn0352: 10072-10127 [+] UCSC Ensembl Mir-370 chrUn0352: 31816-31871 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | GGUCUCGCUGUGAUCACUGUCUCCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGGAAGUCUCCUCAUCUGCUUCCUUCGGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GGUCUCGCUGUGAUCACUGUC--| A U G G C UCAGA UCC GCC GCU AAGCUCAGA GG UCUGAU \ AGG UGG CGG UUCGAGUCU CC AGGCUA A GCUUCCUUCGUCUACUCCUCUGA^ C U - G U CUAGA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ocu-Mir-127_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0048208 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CUGAAGCUCAGAGGGCUCUGAUU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ocu-Mir-127_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0048209 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
34- UCGGAUCCGUCUGAGCUUGGCU -56
Get sequence
|






