| MirGeneDB ID | Ete-Mir-154-P36 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-154 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAUGUUG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Lesser hedgehog tenrec (Echinops telfairi) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ete-Mir-154-P1 Ete-Mir-154-P2-v1 Ete-Mir-154-P2-v2 Ete-Mir-154-P3a-v1 Ete-Mir-154-P3a-v2 Ete-Mir-154-P4a Ete-Mir-154-P4b Ete-Mir-154-P5 Ete-Mir-154-P6 Ete-Mir-154-P7 Ete-Mir-154-P8 Ete-Mir-154-P9 Ete-Mir-154-P10 Ete-Mir-154-P12 Ete-Mir-154-P13 Ete-Mir-154-P14 Ete-Mir-154-P16 Ete-Mir-154-P17 Ete-Mir-154-P18 Ete-Mir-154-P19 Ete-Mir-154-P20-v1 Ete-Mir-154-P20-v2 Ete-Mir-154-P21 Ete-Mir-154-P22 Ete-Mir-154-P24 Ete-Mir-154-P25 Ete-Mir-154-P26 Ete-Mir-154-P27 Ete-Mir-154-P28 Ete-Mir-154-P29 Ete-Mir-154-P30 Ete-Mir-154-P31 Ete-Mir-154-P32 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Bta-Mir-154-P36 Cfa-Mir-154-P36 Cpo-Mir-154-P36 Dno-Mir-154-P36 Hsa-Mir-154-P36 Mml-Mir-154-P36 Mmu-Mir-154-P36 Ocu-Mir-154-P36 Rno-Mir-154-P36 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (echTel2) |
JH980297: 82277923-82277976 [-] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | CACCCGAGCCUGUGCGUGGUACGCGGGGAGAGGUUACCCGAGCAACUUUGCAUCUGGACGACGAAUGUUGCUCGGUGAACCCCAUCUCGGUAUCAGAAUCCACCGGGGAGGCCAGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CACCCGAGCCUGUGCGU---| G AGA AC - CAUCU GGUAC CGGGG GGUU CCGAGCAAC UUUG \ CUAUG GCUCU CCAA GGCUCGUUG AAGC G ACCGGAGGGGCCACCUAAGA^ - ACC GU U AGCAG 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | This gene was classified as a non-canonical miRNA in Fromm et al. (2015) given that the Dicer cut is consistently +4. However, the Drosha cut is +2 and reads are abrogated with the Drosha knock-out and hence it is accepted here. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ete-Mir-154-P36_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGUUACCCGAGCAACUUUGCAU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ete-Mir-154-P36_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
32- GAAUGUUGCUCGGUGAACCCCA -54
Get sequence
|






