| MirGeneDB ID | Dya-Mir-9681 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-9681 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UUCGGAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Fruit fly (Drosophila yakuba) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | dya-mir-9681 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | D. yakuba | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | D. yakuba | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Drosophila_yakuba.dyak_caf1.dna.toplevel) |
2R: 12724136-12724190 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-9681) |
Mir-7
2R: 12702754-12702815 [-]
UCSC
Ensembl
Mir-992 2R: 12723689-12723744 [+] UCSC Ensembl Mir-991 2R: 12723801-12723862 [+] UCSC Ensembl Mir-9681 2R: 12724136-12724190 [+] UCSC Ensembl Mir-92-P6a 2R: 12724560-12724622 [+] UCSC Ensembl Mir-92-P7 2R: 12724704-12724764 [+] UCSC Ensembl Mir-92-P6b 2R: 12724839-12724897 [+] UCSC Ensembl Mir-92-P5 2R: 12724949-12725008 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | CAAUGGAUUUAUUUGCUUUAGGAUUUAUUUUUUCGGACAAUUCAAUCUGGGCGUUGCUUUCGCUGAGGUAGUAUUGUUUGGAAGACUAAGUUAACGAGCAUUCAUCUCAUUUUUGGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CAAUGGAUUUAUUUGCUUUAG--| U UCA G GUUG GAUUUA UUUUUCGGACAAU AUCU GGC \ UUGAAU AGAAGGUUUGUUA UGGA UCG C GUUUUUACUCUACUUACGAGCAA^ C UGA G CUUU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Dya-Mir-9681_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0039168 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UUUCGGACAAUUCAAUCUGGGC -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Co-mature sequence | Dya-Mir-9681_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0039169 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
33- UGAGGUAGUAUUGUUUGGAAGA -55
Get sequence
|






