| MirGeneDB ID | Dsi-Mir-972 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-972 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GUACAAU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Fruit fly (Drosophila simulans) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | dsi-mir-972 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Dme-Mir-972 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | D. melanogaster + D. simulans | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | D. melanogaster + D. simulans | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Drosophila_simulans.ASM75419v3.dna.toplevel) |
X: 18322964-18323019 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-972) |
Mir-972
X: 18322964-18323019 [+]
UCSC
Ensembl
Mir-9369 X: 18323144-18323204 [+] UCSC Ensembl Mir-973 X: 18323323-18323387 [+] UCSC Ensembl Mir-974 X: 18323461-18323522 [+] UCSC Ensembl Mir-975 X: 18330806-18330866 [+] UCSC Ensembl Mir-976 X: 18330933-18330991 [+] UCSC Ensembl Mir-977 X: 18331071-18331133 [+] UCSC Ensembl Mir-978-v1 X: 18333231-18333293 [+] UCSC Ensembl Mir-978-v2 X: 18333232-18333292 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | AAAAAGCUGAAGAGAAUGAUAGUGAAUUGCUAAAUAUUUUCUUUGUAUAAAUGACUUUUAACAUUUGUACAAUAUUAAUAUUUAAACAUUUCUCGAAUCAAAGUAUGCCACAUCAGGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AAAAAGCUGAAGAGAAUGAUAGU- U C-| UUCU UGACU GAA UG UAAAUAUU UUGUAUAAA U CUU AC AUUUAUAA AACAUGUUU U GACUACACCGUAUGAAACUAAGCU U AA^ UUAU ACAAU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Dsi-Mir-972_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0039111 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UAAAUAUUUUCUUUGUAUAAA -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Dsi-Mir-972_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0039112 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- UGUACAAUAUUAAUAUUUAAA -56
Get sequence
|






