| MirGeneDB ID | Dme-Mir-92-P6 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Fruit fly (Drosophila melanogaster) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | dme-mir-311 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Dme-Mir-92-P3 Dme-Mir-92-P4 Dme-Mir-92-P5 Dme-Mir-92-P7 Dme-Mir-92-P8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Asu-Mir-92 Bfl-Mir-92-o6 Bla-Mir-92-o6 Cel-Mir-92 Dan-Mir-92-P6 Dmo-Mir-92-P6 Dsi-Mir-92-P6 Dya-Mir-92-P6a Dya-Mir-92-P6b Esc-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Drosophila | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Drosophila_melanogaster_BDGP6) |
2R: 20583888-20583946 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-P6) |
Mir-92-P5
2R: 20583766-20583825 [-]
UCSC
Ensembl
Mir-92-P6 2R: 20583888-20583946 [-] UCSC Ensembl Mir-92-P7 2R: 20584058-20584117 [-] UCSC Ensembl Mir-92-P8 2R: 20584194-20584254 [-] UCSC Ensembl Mir-991 2R: 20585214-20585275 [-] UCSC Ensembl Mir-992 2R: 20585332-20585390 [-] UCSC Ensembl Mir-7 2R: 20606081-20606142 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | GUGAAAAAUCGAAAUUUCUAGAUCAUUUUUCGGACGGUAUAUGGGUUAAUAUUUCAUUUGUCGAAUAUAUUGCACAUUCACCGGCCUGAAAAUAUCAAGAAUUAACAUCGAAAAGUGAAGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GUGAAAAAUCGAAAUUU---| A C C A AU G U UUCAUU CU GAU AUUUUU GG CGGU AUG GU AAUAU U GA CUA UAAAAG CC GCCA UAC CG UUAUA G AAGUGAAAAGCUACAAUUAA^ A - U G CU A - UAAGCU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Dme-Mir-92-P6_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0020837 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CGGACGGUAUAUGGGUUAAUAUU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Dme-Mir-92-P6_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0000403 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- UAUUGCACAUUCACCGGCCUGA -59
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proposed targets |
microrna.org: MIMAT0000403 TargetScanFly: dme-miR-311 |






