| MirGeneDB ID | Cte-Mir-2-o37 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Polychaete worm (Capitella teleta) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cte-mir-2g | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cte-Mir-2-o36 Cte-Mir-2-o38 Cte-Mir-2-o39 Cte-Mir-2-o40 Cte-Mir-2-o41 Cte-Mir-2-o42 Cte-Mir-2-o43 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | C. teleta | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Capitella_teleta_v1.0) |
CAPTEscaffold_933: 10173-10226 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o37) |
Mir-71
CAPTEscaffold_933: 9934-9996 [+]
Ensembl
Mir-2-o36 CAPTEscaffold_933: 10045-10113 [+] Ensembl Mir-2-o37 CAPTEscaffold_933: 10173-10226 [+] Ensembl Mir-2-o38 CAPTEscaffold_933: 10413-10471 [+] Ensembl Mir-2-o39 CAPTEscaffold_933: 10541-10616 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | UCACCACCCCCUCCUGUGCAUGGCUCACCGCGGUCUCAGCGUCUGUGGUGCGCUGAAUUCGUAUCACAGACCGCUUGGAUCACAGUGCGCUGUUGUGAUGGUUACACUCGUGGUGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UCACCACCCCCUCCUGU- - U CGC C -| CUG GC AUGGC CAC GGUCU AGC GUCUGUGGUGCG \ UG UGUCG GUG CUAGG UCG CAGACACUAUGC A UGGUGCUCACAUUGGUAG U C ACA U C^ UUA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cte-Mir-2-o37_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CGGUCUCAGCGUCUGUGGUGCG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cte-Mir-2-o37_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0013559 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
31- UAUCACAGACCGCUUGGAUCACA -54
Get sequence
|






