| MirGeneDB ID | Cin-Let-7-P2o3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | LET-7 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UGAGGUA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Sea Squirt (Ciona intestinalis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cin-let-7b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cin-Let-7-P1 Cin-Let-7-P2o1-v1 Cin-Let-7-P2o1-v2 Cin-Let-7-P2o2 Cin-Let-7-P2o4 Cin-Let-7-P2o5 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Let-7 Bge-Let-7 Bpl-Let-7 Cgi-Let-7 Cte-Let-7 Dan-Let-7 Dma-Let-7 Dme-Let-7 Dmo-Let-7 Dpu-Let-7 Dsi-Let-7 Dya-Let-7 Esc-Let-7 Hme-Let-7 Isc-Let-7 Lan-Let-7 Lgi-Let-7 Npo-Let-7 Obi-Let-7 Ovu-Let-7 Pfl-Let-7 Pmi-Let-7 Sko-Let-7 Spu-Let-7 Tca-Let-7 Xbo-Let-7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | C. intestinalis | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (ci3) |
4: 2157948-2158018 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Let-7-P2o3) |
Let-7-P2o1-v1
4: 2157421-2157502 [+]
UCSC
Ensembl
Let-7-P2o1-v2 4: 2157422-2157502 [+] UCSC Ensembl Let-7-P2o2 4: 2157552-2157624 [+] UCSC Ensembl Let-7-P2o3 4: 2157948-2158018 [+] UCSC Ensembl Let-7-P2o4 4: 2158141-2158206 [+] UCSC Ensembl Let-7-P2o5 4: 2158340-2158414 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | AUUGUUAAGUAUCCUGAGGUACACCUGCUGUUGAGGUAGUAGGUUAUGUUGUUGCACAUAAUACUGCAUUGGAGAUACACCAUGACCUUCUAACCUCUGCACCAUGUCUAUCACUUUCAACAUGGGGUAAUGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AUUGUUAAGUAUCCUGA-- C C C U -| U U UGCACAUAAUA GGUA AC UG UGU GAGG UAG AGGUUAUG UGU C CUAU UG AC ACG CUCC AUC UCCAGUAC ACA U UAAUGGGGUACAACUUUCA C U C U A^ U C UAGAGGUUACG . 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | This paralogue is related to the vertebrate P2s but it is not yet possible to disentangle the phylogenetic history of vertebrate Let-7 P2s and thus the ascidian genes are classified as orphans pending further data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cin-Let-7-P2o3_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0006087 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UUGAGGUAGUAGGUUAUGUUGU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cin-Let-7-P2o3_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0015249 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
48- ACCAUGACCUUCUAACCUCUGCA -71
Get sequence
|






