| MirGeneDB ID | Cel-Mir-9-P14 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-9 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UAAAGCU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Roundworm (Caenorhabditis elegans) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cel-mir-75 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cel-Mir-9-P15 Cel-Mir-9-P16 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Bfl-Mir-9 Bge-Mir-9-o14 Bla-Mir-9 Bpl-Mir-9 Cbr-Mir-9-P14 Cin-Mir-9 Cte-Mir-9 Esc-Mir-9 Isc-Mir-9 Lan-Mir-9 Lgi-Mir-9 Npo-Mir-9 Obi-Mir-9 Ovu-Mir-9 Pmi-Mir-9 Spu-Mir-9 Xbo-Mir-9 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Caenorhabditis | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (ce11) |
chrX: 2372475-2372534 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-9-P14) |
Mir-73-P1
chrX: 2368787-2368848 [+]
UCSC
Ensembl
Mir-73-P2 chrX: 2369062-2369124 [+] UCSC Ensembl Mir-9-P14 chrX: 2372475-2372534 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | UUUCUACUUUCUUGUUGCUUUGAAGAAUUGCAGUCGGUUGCAAGCUUAAAUACAAAUCCGAAUUGUUAUUAAAGCUACCAACCGGCUUCAAGUCUGAAAGAGCAGUUGAAAAAAGGUAAGGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UUUCUACUUUCUUGUUG- GA-| A C CA A CAAAUC CUUU AGA UUG AGUCGGUUG AGCUU AAUA C GAGA UCU AAC UCGGCCAAC UCGAA UUAU G GAAUGGAAAAAAGUUGAC AAG^ G U CA A UGUUAA . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cel-Mir-9-P14_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0015108 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CAGUCGGUUGCAAGCUUAAAUA -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proposed targets |
microrna.org: MIMAT0015108 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cel-Mir-9-P14_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0000047 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UUAAAGCUACCAACCGGCUUCA -60
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proposed targets |
microrna.org: MIMAT0000047 TargetScanWorm: cel-miR-75 |






