| MirGeneDB ID | Cel-Mir-36-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-36 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CACCGGG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Roundworm (Caenorhabditis elegans) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cel-mir-36 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cel-Mir-36-P1 Cel-Mir-36-P3 Cel-Mir-36-P4 Cel-Mir-36-P5 Cel-Mir-36-P6 Cel-Mir-36-P7 Cel-Mir-36-P8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Bge-Mir-36 Cbr-Mir-36-o2 Cgi-Mir-36 Cte-Mir-36 Dma-Mir-36 Dpu-Mir-36 Isc-Mir-36 Npo-Mir-36 Tca-Mir-36 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | C. elegans | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (ce11) |
chrII: 11537732-11537794 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-36-P2) |
Mir-36-P1
chrII: 11537629-11537689 [+]
UCSC
Ensembl
Mir-36-P2 chrII: 11537732-11537794 [+] UCSC Ensembl Mir-36-P3 chrII: 11537854-11537914 [+] UCSC Ensembl Mir-36-P4 chrII: 11537949-11538011 [+] UCSC Ensembl Mir-36-P5 chrII: 11538103-11538164 [+] UCSC Ensembl Mir-36-P6 chrII: 11538199-11538260 [+] UCSC Ensembl Mir-36-P7 chrII: 11538324-11538389 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | UCCACUUGCUCCACCGCUGUCGGGGAACCGCGCCAAUUUUCGCUUCAGUGCUAGACCAUCCAAAGUGUCUAUCACCGGGUGAAAAUUCGCAUGGGUCCCCGACGCGGAAAGAUAAAAUAUCUUGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 UCCACUUGCUCCACCGCU--| A C C CA C GACCAUC GUCGGGGA CCG GC AAUUUUCGCUU GUG UA C CAGCCCCU GGU CG UUAAAAGUGGG CAC AU A UUCUAUAAAAUAGAAAGGCG^ G A C C- U CUGUGAA 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cel-Mir-36-P2_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0020304 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CGCCAAUUUUCGCUUCAGUGCUA -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cel-Mir-36-P2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0000007 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
41- UCACCGGGUGAAAAUUCGCAUG -63
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proposed targets |
microrna.org: MIMAT0000007 TargetScanWorm: cel-miR-36 |






