| MirGeneDB ID | Cel-Let-7-P8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | LET-7 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GAGGUAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Roundworm (Caenorhabditis elegans) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cel-mir-48 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cel-Let-7-P5 Cel-Let-7-P6 Cel-Let-7-P7 Cel-Let-7-P9 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Let-7 Bge-Let-7 Bpl-Let-7 Cbr-Let-7-P8 Cgi-Let-7 Cte-Let-7 Dan-Let-7 Dma-Let-7 Dme-Let-7 Dmo-Let-7 Dpu-Let-7 Dsi-Let-7 Dya-Let-7 Esc-Let-7 Hme-Let-7 Isc-Let-7 Lan-Let-7 Lgi-Let-7 Npo-Let-7 Obi-Let-7 Ovu-Let-7 Pfl-Let-7 Pmi-Let-7 Sko-Let-7 Spu-Let-7 Tca-Let-7 Xbo-Let-7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Caenorhabditis | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (ce11) |
chrV: 14364435-14364494 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Let-7-P8) |
Let-7-P8
chrV: 14364435-14364494 [-]
UCSC
Ensembl
Let-7-P7 chrV: 14366203-14366268 [-] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | UCAAUUAACCAAUUGAAACUCCCGGGAACUUGAGGUAGGCUCAGUAGAUGCGAAUUGAACGGUAUCUCACAUCCACCAGCCUAGCUCGCAUUCCCAGAGUUUACGGUAUUGUUUUAUUAUGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UCAAUUAACCAAUUGAA---| CC CU G CA A C AUUGAA ACUC GGGAA UGAG UAGGCU GU GAUG GA \ UGAG CCCUU GCUC AUCCGA CA CUAC CU C UAUUAUUUUGUUAUGGCAUU^ A- AC G C- C A CUAUGG . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cel-Let-7-P8_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0000019 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGAGGUAGGCUCAGUAGAUGCGA -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proposed targets |
microrna.org: MIMAT0000019 TargetScanWorm: cel-miR-48 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cel-Let-7-P8_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0015098 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- ACAUCCACCAGCCUAGCUCGCA -60
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proposed targets |
microrna.org: MIMAT0015098 |






