| MirGeneDB ID | Xla-Mir-451-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-451 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AACCGUU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | African clawed frog (Xenopus laevis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Xla-Mir-451-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-451 Ami-Mir-451 Bta-Mir-451 Cfa-Mir-451 Cli-Mir-451 Cmi-Mir-451 Cpi-Mir-451 Cpo-Mir-451 Dno-Mir-451 Dre-Mir-451 Ebu-Mir-451 Ete-Mir-451 Gga-Mir-451 Gja-Mir-451 Gmo-Mir-451 Hsa-Mir-451 Lch-Mir-451 Loc-Mir-451 Mal-Mir-451 Mdo-Mir-451 Mml-Mir-451 Mmu-Mir-451 Mun-Mir-451 Oan-Mir-451 Ocu-Mir-451 Pma-Mir-451 Rno-Mir-451 Sha-Mir-451 Spt-Mir-451 Sto-Mir-451 Tgu-Mir-451 Tni-Mir-451 Xtr-Mir-451 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | X. laevis | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_001663975.1_XLA_v2) |
NC_030727.1: 4343476-4343517 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-451-P2) |
Mir-144-P2-v1
NC_030727.1: 4344085-4344142 [-]
UCSC
Ensembl
Mir-144-P2-v2 NC_030727.1: 4344085-4344142 [-] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UGUUGGGUGGAGACCUGUAGGGUGUCAAUGAAACCGUUACCAUUACUGAGUUUAGUAAUGGUAAGGGUUCUGUUGCUGCUCUUCCAUUCGCUUUUGAGAUUC
Get precursor sequence
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UGUUGGGUGGAGACCUGU--| U GA G A AGGGUG CAAU AACC UUACCAUUACUG G UCUCGU GUUG UUGG AAUGGUAAUGAU U CUUAGAGUUUUCGCUUACCU^ C UC G U 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | As a non-canonical (Group 4, Kim et al. 2016) miRNA there is no discrete 3p read and the 3' end of the mature miRNA is somewhat arbitrary. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | NA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Xla-Mir-451-P2_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AAACCGUUACCAUUACUGAGUU -22
Get sequence
|






