| MirGeneDB ID | Ete-Mir-34-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-34 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GGCAGUG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Lesser hedgehog tenrec (Echinops telfairi) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ete-Mir-34-P2a Ete-Mir-34-P2b Ete-Mir-34-P3b Ete-Mir-34-P3c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-34 Aca-Mir-34-P1 Ami-Mir-34-P1 Asu-Mir-34 Bge-Mir-34 Bta-Mir-34-P1 Cbr-Mir-34 Cel-Mir-34 Cfa-Mir-34-P1 Cgi-Mir-34 Cin-Mir-34 Cli-Mir-34-P1 Cmi-Mir-34-P1 Cpi-Mir-34-P1 Cpo-Mir-34-P1 Cte-Mir-34 Dan-Mir-34 Dma-Mir-34 Dme-Mir-34 Dmo-Mir-34 Dno-Mir-34-P1 Dpu-Mir-34 Dre-Mir-34-P1 Dsi-Mir-34 Dya-Mir-34 Ebu-Mir-34-P1 Efe-Mir-34 Esc-Mir-34 Gga-Mir-34-P1 Gja-Mir-34-P1 Gmo-Mir-34-P1 Hsa-Mir-34-P1 Isc-Mir-34 Lch-Mir-34-P1 Lgi-Mir-34 Loc-Mir-34-P1 Mal-Mir-34-P1 Mdo-Mir-34-P1 Mml-Mir-34-P1 Mmu-Mir-34-P1 Mun-Mir-34-P1 Npo-Mir-34 Oan-Mir-34-P1 Obi-Mir-34 Ocu-Mir-34-P1 Ovu-Mir-34 Pbv-Mir-34-P1 Pfl-Mir-34 Pma-Mir-34-P1 Pmi-Mir-34 Rno-Mir-34-P1 Sha-Mir-34-P1 Sko-Mir-34 Spt-Mir-34-P1 Spu-Mir-34 Sto-Mir-34-P1 Tca-Mir-34 Tgu-Mir-34-P1 Tni-Mir-34-P1 Xbo-Mir-34 Xla-Mir-34-P1a Xla-Mir-34-P1b Xtr-Mir-34-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (echTel2) |
JH980313: 35864123-35864188 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | GGCGUGGCGGGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAUCAAUGGUGAAGGAAGCAAUCAGCAAGUACACUGCCCUAGAAGUGCUGCACGUUGGGGGGCCCAGAGGGGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GGCGUGGCGGGCCAGCU- - UG UU -| A GUGAUCAA GUG AG UUUCU GGCAGUGU CUU GCUGGUUGUU U CAC UC GAAGA CCGUCACA GAA CGACUAACGA G GGGAGACCCGGGGGGUUG G GU UC U^ - AGGAAGUG 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Dicer cut -1 on both arms. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ete-Mir-34-P1_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGGCAGUGUCUUAGCUGGUUGUU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ete-Mir-34-P1_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
43- CAAUCAGCAAGUACACUGCCCUA -66
Get sequence
|






